Journal: Genome Medicine

Article Title: Targeted genomic analysis reveals widespread autoimmune disease association with regulatory variants in the TNF superfamily cytokine signalling network

doi: 10.1186/s13073-016-0329-5

Figure Lengend Snippet: eQTLs are independent of total magnitude of gene expression and not preferentially associated with active enhancer marks. a Expression of TNFSF and TNFRSF members was measured by the NanoString nCounter analysis system. Each point represents average expression over eight or more individuals, including healthy controls and individuals with IBD. Genes are listed left to right in order of decreasing number of cell types in which an eQTL was detected. b Average H3K27ac ChIP-seq or input DNA sequencing counts per million intersecting TNFSF-related eQTL SNPs in the same cell type are plotted. c Average H3K27ac ChIP-seq counts per million intersecting eQTL SNPs in the same cell type are compared with a random distribution of intersections created by selecting the same number of SNPs from the cis genomic regions used for eQTL search. Error bars represent the standard deviation of 10,000 iterations of random selection. d eQTL chi-squared scores from the strongest eQTL SNP for each TNFSF-related gene (regardless of whether the association passed our eQTL significance threshold) are compared with H3K27ac ChIP-seq or input DNA sequencing counts per million at the same SNPs. Spearman correlation coefficient ( rho ) and correlation p values ( p ) are indicated for H3K27ac ChIP-seq counts per million versus eQTL score

Article Snippet: H3K27ac chromatin immunoprecipitation sequencing (ChIP-seq) and ChIP input DNA sequencing .bed files for CD4 + T cells, CD8 + T cells and CD14 + monocytes were obtained from the NIH Roadmap Epigenomics Project datasets [ ] available through the Gene Expression Omnibus (GEO) database [ ]: H3K27ac CD4+ CD25− primary cells, GSM997239; input CD4+ CD25− primary cells, GSM1112781; H3K27ac CD8 primary cells, GSM1102781; input CD8 primary cells, GSM1102806; H3K27ac CD14 primary cells, GSM1102782; input CD14 primary cells, GSM1102807.

Techniques: Gene Expression, Expressing, ChIP-sequencing, DNA Sequencing, Standard Deviation, Selection

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 2. MyoD and Myf5 Suppressed the BA Fate by Transcriptionally Repressing Prdm16 (A) FACS-isolated MPCs from 2-month-old wild-type mice were first transfected with different siRNAs as indicated. Cells were then cultured in the pro-adipogenic media for 5 days followed by oil red O staining (top panels; scale bar, 50 mm) or UCP1 immunostaining (red) (bottom panels; scale bar, 20 mm). The ratio of the UCP1+ BAs was quantified by counting more than 100 cells from three randomly chosen fields. The nuclei were counterstained by DAPI (blue). (B) FACS-isolated MPCs were infected with adenoviruses expressing shLacZ or shMyoD (n = 3 mice). The mRNA expression of selected genes was measured by qRT-PCR 36 hr after infection. (C) Quadruplicate C2C12 cells were first transfected with siRNAs as indicated and then cultured in the pro-adipogenic media for 4 days. Left: 3/4 of cells were subjected to oil red O staining. Scale bar, 50 mm. Middle: Quantification of the intracellular oil red O by measuring the absorbance at 500 nm. Right: 1/4 of the cells were subjected to western blotting. Data are presented as mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Cell Culture, Staining, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Western Blot

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 3. E2f4 Is a Direct Transcription Target of MyoD/Myf5 MPCs used below Were Isolated by FACS from 2-Month-Old Wild-Type Mice (A) Sorted cells were fixed after either 1 hr of plating (i.e., quiescent satellite cells or QSC) or 1 day of culturing (i.e., activated satellite cells or ASC) followed by immunostaining for E2F4 (green). (B) MPCs from three mice were separately infected with adenoviruses expressing indicated shRNAs; 36 h later, the E2f4 mRNA levels were measured by qRT-PCR. (C) MPCs were transfected with siRNAs as indicated. E2F4 protein levels were measured by western blotting. (D) Top: schematic of the E2f4 promoter. TSS, transcription start site; blue boxes, exons; black box, the E box. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with a MyoD antibody or an immunoglobulin G control. The fold enrichment of MyoD on the specific E box in the E2f4 promoter is shown. NS, non-specific site. (E and F) MPCs (E) and C2C12 myoblasts (F) were transfected with siRNAs as indicated; 24 hr post transfection, cells were cultured in the pro-adipogenic media for 4 days followed by oil red O staining. Data are presented as mean ± SD. **p < 0.01, ***p < 0.001. Scale bars, 30 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Immunostaining, Infection, Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Cell Culture, Staining

Journal: Developmental cell

Article Title: A Molecular Switch Regulating Cell Fate Choice between Muscle Progenitor Cells and Brown Adipocytes.

doi: 10.1016/j.devcel.2017.04.012

Figure Lengend Snippet: Figure 4. Prdm16 Is a Direct Transcription Target of the E2F4/p107/p130 Repressive Complex (A) FACS-isolated MPCs in triplicate were transfected with siRNAs as indicated. Relative gene expression was measured by qRT-PCR 24 hr after transfection. (B) Top: schematic of the Prdm16 promoter. #1 and #2 indicate the predicted E2F4 binding sites (black boxes). Blue box, exons. Bottom: ChIP assays (n = 3) were performed using lysates from proliferating C2C12 myoblasts with specific antibodies as indicated. The fold enrichment of E2F4, p107, or p130 on two potential E2F4 binding sites in the Prdm16 promoter and a known E2F4 binding site in the PPARg promoter (control) is shown. (C–F) C2C12 cells in triplicate were co-transfected with various luciferase reporters, siRNAs, and/or cDNA expression vectors as indicated. Cells were harvested 24 hr after transfection and luciferase activities were measured. In (C) and (D), a luciferase reporter construct carrying a 1.5-kb mouse Prdm16 proximal promoter was used. In (E), two luciferase reporter constructs were used, each carrying a short fragment of the Prdm16 promoter with one of the two (i.e., #1, #2) potential E2F4 binding sites. In (F), two luciferase reporter constructs were used, one carrying three copies of the wild-type E2F4 binding site (CGCAGC) found in site #2 and the other three copies of the mutated E2F4 binding site (CTCCTC). In (A)–(F), Fold changes were calculated. Data are presented as means ± SD. *p < 0.05, **p < 0.01, ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Pax7 RNA-seq in MPC This paper GEO: GSE97690 ChIP-seq of MyoD binding regions in C2C12 myoblasts at 50% confluency Cao et al., 2010 SRA: SRS010090 MyoD ChIP-seq on mouse C2C12 ENCODE ENCSR000AIG Experimental Models: Cell Lines Mouse: C2C12 ATCC CRL-1772 Experimental Models: Organisms/Strains Mouse: Pax7tm2.1(cre/ERT2)Fan/J Jackson Laboratory JAX: 012476 Mouse: Pax7tm1.1Fan/J Jackson Laboratory JAX: 012653 Mouse: Pax7tm1(cre/ERT2)Gaka/J Jackson Laboratory JAX: 017763 Mouse: Gt(ROSA)26Sortm1(EYFP)Cos/J Jackson Laboratory JAX: 006148 Oligonucleotides qPCR primers for gene expression This paper See Table S1 ChIP-qPCR primer for E2f4 E box Fwd: GATGCCTACTTAAAGAGAAACAGG This paper N/A ChIP-qPCR primer for E2f4 E box Rev: CCACTATATTGCCCAAGAACC This paper N/A ChIP-qPCR primer for Prdm16#1 Fwd: CGACGAAGAGGATGATGAACAC This paper N/A ChIP-qPCR primer for Prdm16#1 Rev: TCCCTAGCATTGTCAGTTTGGA This paper N/A ChIP-qPCR primer for Prdm16#2 Fwd: CTTGAAGTTTATTCCCAAGTGGTG This paper N/A ChIP-qPCR primer for Prdm16#2 Rev: GCGAAAGAGAAAGTAAGCCC This paper N/A ChIP-qPCR primer for Pparg Fwd: GACTCAGGGACAGAGTGAGG This paper N/A ChIP-qPCR primer for Pparg Rev: CGGTAGTTCTGGAGACCTGG This paper N/A siRNA sequence for GFP 5’-GCUGACCCUGAAGUUCAUC This paper N/A siRNA sequence for Myod 5’-GCAGAAGUCUGUCCUAGAU This paper N/A siRNA sequence for Myf5 5’-CUAAUUUGUUUCUUGGCCU This paper N/A siRNA sequence for Prdm16 5’-GAAGAGCGUGAGUACAAAU This paper N/A siRNA sequence for Pax7 5’-GAAUCAAGUUCGGGAAGAA This paper N/A siRNA sequence for E2f4 5’-GCCAGAAGAAGUACCAGAU This paper N/A siRNA sequence for p107 5’-GCCCUGAUUUAAUGAAAGA This paper N/A siRNA sequence for p130 5’-GGCCGUUAAUAAGGCAUAU This paper N/A Negative control miRNA inhibitor Ribobio Cat#miR02201-1-5 Mir-133a inhibitor Ribobio Cat#miR20003473-1-5 Recombinant DNA pGL3-Basic Vector Promega Cat#E1751 pGL3-Promoter Vector Promega Cat#E1761 pAd/BLOCK-iT-DEST RNAi Gateway Vector ThermoFisher Cat#V49220 (Continued on next page) Developmental Cell 41, 382–391.e1–e5, May 22, 2017 e2

Techniques: Isolation, Transfection, Gene Expression, Quantitative RT-PCR, Binding Assay, Control, Luciferase, Expressing, Construct

Journal: bioRxiv

Article Title: CD44 regulates epigenetic plasticity by mediating iron endocytosis

doi: 10.1101/693424

Figure Lengend Snippet: ( A ) Schematic illustration of the catalytic cycle of iron-mediated oxidative demethylation of a methylated lysine residue. Active site of PHF8 enzyme (black) bound to iron (red), together with molecular oxygen (pink) and αKG (blue) co-substrates required for demethylation are shown. ( B – I ) MDA-MB-468 cells were used throughout the figure and were treated with EGF for 72 h. ( B ) Subcellular fractionation and western blot analysis of nuclear ferritin levels. NE, nuclear extract; CE, cytoplasmic extract; WCE, whole cell extract. Data showing increased levels of the iron storage protein ferritin in the nucleus of mesenchymal cells. ( C ) Quantitative mass spectrometry. Heatmap of H3K9me2, H3K9me3 and H3K27me3 levels showing a reduction of the repressive histone mark H3K9me2 in the mesenchymal state of cells. n = 5 biological replicates. P ≤ 0.0001 for H3K9me2 and n.s. for H3K9me3 and H3K27me3; two-sided associated t -tests. ( D ) Western blot analysis of levels of H3K9me2 in PHF8 knock down conditions. Data showing that knocking down PHF8 antagonizes the reduction of H3K9me2 induced by EGF. Bars and error bars, mean values ± s.d. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001; n.s., not significant; unpaired t -tests. ( E ) H3K9me2 ChIP-seq profiles of selected genes. Data showing the reduction of H3K9me2 ChIP-seq reads count in the gene body of these mesenchymal and pro-metastatic genes. ( F ) Scatter plot correlation of H3K9me2 ChIP-seq reads count in genes ( n = 3 biological replicates) and RNA-seq ( n = 2 biological replicates). Data showing that reduction of H3K9me2 reads count in specific genes correlates with increased expression of these genes. ( G ) Western blot analysis of proteins whose genes are regulated by H3K9me2 in PHF8 knock down conditions. Data showing that knocking down PHF8 antagonizes the upregulation of iron-regulated genes in cells treated with EGF. ( H ) Western blot analysis of H3K9me2 levels in CD44 knock down conditions. Data showing that knocking down CD44 antagonizes the reduction of H3K9me2 in cells treated with EGF. ( I ) Western blot analysis of levels of proteins whose genes are regulated by H3K9me2 in CD44 knock down conditions. Data showing that knocking down CD44 antagonizes the upregulation of iron-regulated genes in cells treated with EGF. See also .

Article Snippet: CD109 (Santa Cruz Biotechnology, #sc-271085, WB: 1:500), CD24-APC (Sony Biotechnology Inc., #2155590, FC: 1 μL/10 6 cells), CD44 (Abcam, #ab189524, WB: 1:30000, FM: 1:200), CD44 (Abcam, #ab25340, FC, blocking: 10 μg/mL, 1 h), CD44 Alexa-Fluor-647 (Novus Biologicals, #NB500-481AF647, FC: 1 μL/10 6 cells), CD44 (R&D Systems, #FAB4948P, FC: 10 μL/10 6 cells), CDCP1 (Cell Signaling, #4115, WB: 1:1000), Drosophila spike-in antibody (Active Motif, #61686, ChIP-seq: 1 μg), E-cadherin (Cell Signaling, #20023195, WB: 1:1000, IF: 1:200), Ferritin (Abcam, #ab75973, WB: 1:1000), Fibronectin (Sigma-Aldrich, #F0791, WB: 1:1000), FSCN1 (Abcam, #ab126772, WB: 1:1000), H3 (Cell Signaling, #9715S, WB: 1:10 6 ), H3K9me2 (Cell Signaling, #4658S, WB: 1:1000, ChIP-seq: 6 μL), MGLL (Abcam, #ab24701, WB: 1:1000), PHF8 (Active Motif, #39711, WB: 1:1000), Transferrin receptor 1 (TfR1, Life Technologies, #13-6800, WB: 1:1000), Transferrin receptor 1 (TfR1, Merck Millipore, #GR09L-100UG, FC, blocking: 10 μg/mL, 1 h), TfR1-PE (R&D Systems, #FAB2474P, FC: 5 μL/10 6 cells), β-Tubulin (Sigma-Aldrich, #T4026-100UL, WB: 1:2000), γ-Tubulin (Sigma-Aldrich, #T5326, WB: 1:2000), Vimentin (Cell Signaling, #3932, WB: 1:500), Zeb1 (Santa Cruz Biotechnology, #sc-81428, WB: 1:500).

Techniques: Methylation, Residue, Fractionation, Western Blot, Mass Spectrometry, Knockdown, ChIP-sequencing, RNA Sequencing, Expressing

Journal: bioRxiv

Article Title: CD44 regulates epigenetic plasticity by mediating iron endocytosis

doi: 10.1101/693424

Figure Lengend Snippet: List of selected genes identified by ChIP-seq where reduction of H3K9me2 reads count correlates with the upregulation of RNA transcripts. CD44 has previously been linked to biological processes implicating iron-regulated genes. These processes include cancer progression, EMT, development, immune responses, inflammation and wound healing.

Article Snippet: CD109 (Santa Cruz Biotechnology, #sc-271085, WB: 1:500), CD24-APC (Sony Biotechnology Inc., #2155590, FC: 1 μL/10 6 cells), CD44 (Abcam, #ab189524, WB: 1:30000, FM: 1:200), CD44 (Abcam, #ab25340, FC, blocking: 10 μg/mL, 1 h), CD44 Alexa-Fluor-647 (Novus Biologicals, #NB500-481AF647, FC: 1 μL/10 6 cells), CD44 (R&D Systems, #FAB4948P, FC: 10 μL/10 6 cells), CDCP1 (Cell Signaling, #4115, WB: 1:1000), Drosophila spike-in antibody (Active Motif, #61686, ChIP-seq: 1 μg), E-cadherin (Cell Signaling, #20023195, WB: 1:1000, IF: 1:200), Ferritin (Abcam, #ab75973, WB: 1:1000), Fibronectin (Sigma-Aldrich, #F0791, WB: 1:1000), FSCN1 (Abcam, #ab126772, WB: 1:1000), H3 (Cell Signaling, #9715S, WB: 1:10 6 ), H3K9me2 (Cell Signaling, #4658S, WB: 1:1000, ChIP-seq: 6 μL), MGLL (Abcam, #ab24701, WB: 1:1000), PHF8 (Active Motif, #39711, WB: 1:1000), Transferrin receptor 1 (TfR1, Life Technologies, #13-6800, WB: 1:1000), Transferrin receptor 1 (TfR1, Merck Millipore, #GR09L-100UG, FC, blocking: 10 μg/mL, 1 h), TfR1-PE (R&D Systems, #FAB2474P, FC: 5 μL/10 6 cells), β-Tubulin (Sigma-Aldrich, #T4026-100UL, WB: 1:2000), γ-Tubulin (Sigma-Aldrich, #T5326, WB: 1:2000), Vimentin (Cell Signaling, #3932, WB: 1:500), Zeb1 (Santa Cruz Biotechnology, #sc-81428, WB: 1:500).

Techniques: ChIP-sequencing

Journal: bioRxiv

Article Title: CD44 regulates epigenetic plasticity by mediating iron endocytosis

doi: 10.1101/693424

Figure Lengend Snippet: ( A ) Molecular structure of cDFO (top), schematic illustration of the chemical labeling of cDFO in cells (bottom) and corresponding fluorescence microscopy images (right). 488 represents the Alexa-Fluor-488 fluorophore and has been chosen arbitrarily. Data showing that labeled DFO colocalizes with DAPI, preferentially targeting the nucleus. Scale bar, 10 μm. ( B ) Western blot analysis of H3K9me2 levels in cells cotreated with EGF and DFO. Data showing that targeting nuclear iron antagonizes the effect of EGF, preventing the reduction of H3K9me2. ( C ) Western blot analysis of proteins whose genes are regulated by H3K9me2 in cells cotreated with EGF and DFO. Data showing that targeting nuclear iron antagonizes the effect of EGF, preventing the upregulation of iron-regulated genes. ( D ) Quantification of αKG using an αKG titration assay ( n = 2 technical replicates) and western blot analysis of H3K9me2 levels in cells cotreated with EGF and metformin. Data showing that targeting mitochondrial metabolism antagonizes the effect of EGF, preventing the reduction of H3K9me2. ( E ) Cell viability curves of cells cotreated with EGF and ironomycin. Data showing that cells in the mesenchymal state are more vulnerable to lysosomal iron targeting compared to cells in the epithelial state. n = 3 biological replicates. Bars and error bars, mean values ± s.d. * P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, **** P ≤ 0.0001; n.s., not significant; unpaired t -tests. See also .

Article Snippet: CD109 (Santa Cruz Biotechnology, #sc-271085, WB: 1:500), CD24-APC (Sony Biotechnology Inc., #2155590, FC: 1 μL/10 6 cells), CD44 (Abcam, #ab189524, WB: 1:30000, FM: 1:200), CD44 (Abcam, #ab25340, FC, blocking: 10 μg/mL, 1 h), CD44 Alexa-Fluor-647 (Novus Biologicals, #NB500-481AF647, FC: 1 μL/10 6 cells), CD44 (R&D Systems, #FAB4948P, FC: 10 μL/10 6 cells), CDCP1 (Cell Signaling, #4115, WB: 1:1000), Drosophila spike-in antibody (Active Motif, #61686, ChIP-seq: 1 μg), E-cadherin (Cell Signaling, #20023195, WB: 1:1000, IF: 1:200), Ferritin (Abcam, #ab75973, WB: 1:1000), Fibronectin (Sigma-Aldrich, #F0791, WB: 1:1000), FSCN1 (Abcam, #ab126772, WB: 1:1000), H3 (Cell Signaling, #9715S, WB: 1:10 6 ), H3K9me2 (Cell Signaling, #4658S, WB: 1:1000, ChIP-seq: 6 μL), MGLL (Abcam, #ab24701, WB: 1:1000), PHF8 (Active Motif, #39711, WB: 1:1000), Transferrin receptor 1 (TfR1, Life Technologies, #13-6800, WB: 1:1000), Transferrin receptor 1 (TfR1, Merck Millipore, #GR09L-100UG, FC, blocking: 10 μg/mL, 1 h), TfR1-PE (R&D Systems, #FAB2474P, FC: 5 μL/10 6 cells), β-Tubulin (Sigma-Aldrich, #T4026-100UL, WB: 1:2000), γ-Tubulin (Sigma-Aldrich, #T5326, WB: 1:2000), Vimentin (Cell Signaling, #3932, WB: 1:500), Zeb1 (Santa Cruz Biotechnology, #sc-81428, WB: 1:500).

Techniques: Labeling, Fluorescence, Microscopy, Western Blot, Titration

Journal: bioRxiv

Article Title: CD44 regulates epigenetic plasticity by mediating iron endocytosis

doi: 10.1101/693424

Figure Lengend Snippet: ( A )Western blot analysis of H3K9me2 levels in cells cotreated with EGF and DFO. Data showing that targeting nuclear iron antagonizes the effect of EGF, preventing the reduction of H3K9me2. ( B ) Western blot analysis of proteins whose genes are regulated by H3K9me2 in cells cotreated with EGF and DFO. Data showing that targeting nuclear iron antagonizes the effect of EGF, preventing the upregulation of iron-regulated genes. ( C )Molecular structure of pDFO (top), titration of αKG (bottom left, n = 2 technical replicates) and western blot analysis of H3K9me2 levels (bottom right) in cells cotreated with EGF and pDFO. Data showing that targeting mitochondrial iron antagonizes the effect of EGF, blocking the production of αKG, the reduction of H3K9me2 and the upregulation of CD44.

Article Snippet: CD109 (Santa Cruz Biotechnology, #sc-271085, WB: 1:500), CD24-APC (Sony Biotechnology Inc., #2155590, FC: 1 μL/10 6 cells), CD44 (Abcam, #ab189524, WB: 1:30000, FM: 1:200), CD44 (Abcam, #ab25340, FC, blocking: 10 μg/mL, 1 h), CD44 Alexa-Fluor-647 (Novus Biologicals, #NB500-481AF647, FC: 1 μL/10 6 cells), CD44 (R&D Systems, #FAB4948P, FC: 10 μL/10 6 cells), CDCP1 (Cell Signaling, #4115, WB: 1:1000), Drosophila spike-in antibody (Active Motif, #61686, ChIP-seq: 1 μg), E-cadherin (Cell Signaling, #20023195, WB: 1:1000, IF: 1:200), Ferritin (Abcam, #ab75973, WB: 1:1000), Fibronectin (Sigma-Aldrich, #F0791, WB: 1:1000), FSCN1 (Abcam, #ab126772, WB: 1:1000), H3 (Cell Signaling, #9715S, WB: 1:10 6 ), H3K9me2 (Cell Signaling, #4658S, WB: 1:1000, ChIP-seq: 6 μL), MGLL (Abcam, #ab24701, WB: 1:1000), PHF8 (Active Motif, #39711, WB: 1:1000), Transferrin receptor 1 (TfR1, Life Technologies, #13-6800, WB: 1:1000), Transferrin receptor 1 (TfR1, Merck Millipore, #GR09L-100UG, FC, blocking: 10 μg/mL, 1 h), TfR1-PE (R&D Systems, #FAB2474P, FC: 5 μL/10 6 cells), β-Tubulin (Sigma-Aldrich, #T4026-100UL, WB: 1:2000), γ-Tubulin (Sigma-Aldrich, #T5326, WB: 1:2000), Vimentin (Cell Signaling, #3932, WB: 1:500), Zeb1 (Santa Cruz Biotechnology, #sc-81428, WB: 1:500).

Techniques: Western Blot, Titration, Blocking Assay